Stem-loop sequence bna-MIR161

AccessionMI0006479 (change log)
DescriptionBrassica napus miR161 stem-loop
Gene family MIPF0000455; MIR161
Literature search

4 open access papers mention bna-MIR161
(5 sentences)

Stem-loop
   --     u   uc          c              c    auuuguuuuuaaguuuuugcucuca 
5'   uuuau gcu  gaucaaugca ugaaagugacuaca cagg                         u
     ||||| |||  |||||||||| |||||||||||||| ||||                          
3'   aggua cga  cuaguugcgu acuuucacugaugu gucu                         c
   aa     -   ua          a              a    ccgauuaaaaguagaaauaguauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ512955: 329-463 [+]
intergenic
Database links

Mature sequence bna-miR161

Accession MIMAT0005634
Sequence

14 - 

ucaaugcacugaaagugacua

 - 34

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).