Stem-loop sequence bna-MIR164a

AccessionMI0006478 (change log)
Previous IDsbna-MIR164
DescriptionBrassica napus miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

9 open access papers mention bna-MIR164a
(15 sentences)

Stem-loop
   ccac       a  ca             ccaacaa   c    u 
5'     guuggag ag  gggcacgugcaaa       aca gaga c
       ||||||| ||  |||||||||||||       ||| ||||  
3'     caaccuc uc  cucgugcacguuu       ugu cucu u
   -gua       c  ac             -----aa   a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CW984396: 577-662 [-]
intergenic
EM:DX051151: 403-488 [+]
intergenic
Database links

Mature sequence bna-miR164a

Accession MIMAT0005633
Previous IDsbna-miR164
Sequence

7 - 

uggagaagcagggcacgugca

 - 27

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2