Stem-loop sequence bna-MIR166d

AccessionMI0006477 (change log)
DescriptionBrassica napus miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention bna-MIR166d
(31 sentences)

Stem-loop
   ----------guggu     -uu g     a a   c  uu      cu     -    ga  aaugaa 
5'                gcggu   a ggcug g gga ug  gucugg  cgagg ucau  ag      a
                  |||||   | ||||| | ||| ||  ||||||  ||||| ||||  ||       
3'                cgcua   u ccgac c ccu ac  cggacc  gcucu agua  uc      c
   cacccguauauauac     uuu g     c c   u  uu      ag     u    aa  caaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189313: 1397-1524 [+]
intergenic
Database links

Mature sequence bna-miR166d

Accession MIMAT0005632
Sequence

77 - 

ucggaccaggcuucauucccc

 - 97

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2