Stem-loop sequence bna-MIR166c

AccessionMI0006476 (change log)
DescriptionBrassica napus miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention bna-MIR166c
(31 sentences)

Stem-loop
   -gagccaa     c   u      u      cu   -g c     --aa   g     ug g  g 
5'         aaguu agg ggauga gcuugg  cga  a cauua    uau aucau  u au u
           ||||| ||| |||||| ||||||  |||  | |||||    ||| |||||  | ||  
3'         uucaa ucc cuuacu cggacc  gcu  u guaau    aua uagua  a ua u
   uuugcaca     c   c      u      ag   ga a     agua   g     gu g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189591: 82389-82516 [+]
intergenic
Database links

Mature sequence bna-miR166c

Accession MIMAT0005631
Sequence

93 - 

ucggaccaggcuucauucccc

 - 113

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2