Stem-loop sequence bna-MIR166b

Accession

MI0006475

Description

Brassica napus miR166b stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

     c   u      u      cu   g c   --------   a   g     ug g  g 
aaguu agg ggauga gcuugg  cga a cau        uca uau aucau  u au a
||||| ||| |||||| ||||||  ||| | |||        ||| ||| |||||  | ||  
uucaa ucc cuuacu cggacc  gcu u gua        agu aua uagua  a ua u
     c   c      u      ag   g a   auaguaau   a   g     gu g  g 

Genome context

Coordinates (BrassicaDB-20080411)	Overlapping transcripts
EM:BH423978: 306-423 [+]	intergenic
EM:BH680789: 165-282 [-]	intergenic

Mature sequence bna-miR166b

• Accession: MIMAT0005630
• Sequence: 91 - ucggaccaggcuucauucccc - 111
• Evidence: experimental; cloned [1]

References

1. PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).