Stem-loop sequence bna-MIR166b

AccessionMI0006475 (change log)
DescriptionBrassica napus miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

10 open access papers mention bna-MIR166b
(32 sentences)

Stem-loop
        c   u      u      cu   g c   --------   a   g     ug g  g 
5' aaguu agg ggauga gcuugg  cga a cau        uca uau aucau  u au a
   ||||| ||| |||||| ||||||  ||| | |||        ||| ||| |||||  | ||  
3' uucaa ucc cuuacu cggacc  gcu u gua        agu aua uagua  a ua u
        c   c      u      ag   g a   auaguaau   a   g     gu g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH423978: 306-423 [+]
intergenic
EM:BH680789: 165-282 [-]
intergenic
Database links

Mature sequence bna-miR166b

Accession MIMAT0005630
Sequence

91 - 

ucggaccaggcuucauucccc

 - 111

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).