Stem-loop sequence bna-MIR166a

AccessionMI0006474 (change log)
DescriptionBrassica napus miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention bna-MIR166a
(35 sentences)

Stem-loop
   -uuga       uu      cu   a        cuu   --au        uucuucgauuuaaucga 
5'      gggaaug  guuugg  cga gacucuag   auc    guuagauc                 a
        |||||||  ||||||  ||| ||||||||   |||    ||||||||                  
3'      cccuuac  cggacc  gcu cugggauu   uag    uagucuag                 u
   aaccc       uu      ag   g        --u   gauu        aguuuguaccuccaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DX911364: 697-831 [-]
intergenic
Database links

Mature sequence bna-miR166a

Accession MIMAT0005629
Sequence

111 - 

ucggaccaggcuucauucccc

 - 131

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).