Stem-loop sequence bna-MIR167c

AccessionMI0006473 (change log)
DescriptionBrassica napus miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

8 open access papers mention bna-MIR167c
(31 sentences)

Stem-loop
        ac   -  u u a         c             ua  -     uu ---         ua 
5' ggugc  cgg ca c g ugaagcugc agcaugaucuagu  ac uuuau  c   uccguuguu  u
   |||||  ||| || | | ||||||||| |||||||||||||  || |||||  |   |||||||||  c
3' cuacg  guc gu g c acuuugaug uuguacuagauua  ug gaaua  g   agguaacag  c
        cu   a  u c c         c             gc  u     gg aaa         ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189327: 100866-100999 [+]
intergenic
EM:DX037998: 153-286 [-]
intergenic
EM:EV043346: 100-233 [+]
intergenic
EM:EV055825: 89-222 [+]
intergenic
Database links

Mature sequence bna-miR167c

Accession MIMAT0005628
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2