Stem-loop sequence bna-MIR167b

AccessionMI0006472 (change log)
DescriptionBrassica napus miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

8 open access papers mention bna-MIR167b
(31 sentences)

Stem-loop
       cac   -  u u a         c               --u   ---     c        
5' ggcg   cgg ca c g ugaagcugc agcaugaucuaauua   cuu   ucuuu ucuguug 
   ||||   ||| || | | ||||||||| |||||||||||||||   |||   ||||| |||||| a
3' ccgc   guc gu g c acuuugacg uuguacuagauuagu   gag   agaaa agguagc 
       ucu   a  u c c         c               ugu   uac     -        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:CT022223: 635-758 [-]
intergenic
Database links

Mature sequence bna-miR167b

Accession MIMAT0005627
Sequence

18 - 

ugaagcugccagcaugaucuaa

 - 39

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).