Stem-loop sequence bna-MIR167a

AccessionMI0006471 (change log)
DescriptionBrassica napus miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

8 open access papers mention bna-MIR167a
(32 sentences)

Stem-loop
        -    g  ucu a         c             ua  u   uu     guuga      g 
5' ggugu acag ca   g ugaagcugc agcaugaucuaau  ac uuc  ucucu     uuuuau a
   ||||| |||| ||   | ||||||||| |||||||||||||  || |||  |||||     ||||||  
3' ccacg uguc gu   c acuuugacg uuguacuagauua  ug gag  agaga     aaggua c
        c    a  uac c         c             gc  u   -u     ----a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DX028242: 512-643 [-]
intergenic
Database links

Mature sequence bna-miR167a

Accession MIMAT0005626
Sequence

18 - 

ugaagcugccagcaugaucuaa

 - 39

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).