Stem-loop sequence bna-MIR168a

AccessionMI0006470 (change log)
Previous IDsbna-MIR168
DescriptionBrassica napus miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

8 open access papers mention bna-MIR168a
(18 sentences)

Stem-loop
        g   c   u  c              u     a      --g   g   cc    --     c 
5' uuacg cgg cuc ga ucgcuuggugcagg cggga cugauu   gcu aca  gcca  cgugg u
   ||||| ||| ||| || |||||||||||||| ||||| ||||||   ||| |||  ||||  |||||  
3' agugc gcc gag cu agugaacuauguuc gcccu ggcuag   cga ugu  cggu  guacc u
        a   u   c  a              c     a      gga   g   -u    ug     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189658: 41467-41599 [-]
intergenic
EM:DU984956: 260-392 [-]
intergenic
Database links

Mature sequence bna-miR168a

Accession MIMAT0005625
Previous IDsbna-miR168
Sequence

18 - 

ucgcuuggugcaggucgggaa

 - 38

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2