Stem-loop sequence bna-MIR169m

AccessionMI0006469 (change log)
DescriptionBrassica napus miR169m stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

11 open access papers mention bna-MIR169m
(42 sentences)

Stem-loop
   u   u     ag      a     g     au      u  uaau         a          auu      aagaauuu 
5'  aua guauc  agaguc ugcau ggaaa  agagaa ga    gagccaaag ugacuugccg   uuacca        a
    ||| |||||  |||||| ||||| |||||  |||||| ||    ||||||||| ||||||||||   ||||||        a
3'  uau uauag  ucucag augua cuuuu  ucucuu cu    cucgguuuc gcugaacggu   aguggu        a
   -   c     -a      a     g     cu      c  uugu         a          --c      aauaguca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ021311: 350-512 [-]
intergenic
Database links

Mature sequence bna-miR169m

Accession MIMAT0005624
Sequence

45 - 

ugagccaaagaugacuugccg

 - 65

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).