Stem-loop sequence bna-MIR169k

AccessionMI0006467 (change log)
DescriptionBrassica napus miR169k stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169k
(42 sentences)

Stem-loop
   aaacggugaca   --    u   a   u  g   -     a    u    u      -    uaac    ua   c     uua 
5'            uga  agaa gag agu gu ugg uagcc agga gacu gccugc gucu    acca  uca agacu   u
              |||  |||| ||| ||| || ||| ||||| |||| |||| |||||| ||||    ||||  ||| |||||    
3'            acu  ucuu cuc uca ca acu aucgg uccu cuga cggaug cgga    uggu  agu ucuga   c
   -------cuuu   cc    u   c   -  g   u     c    -    -      u    ---u    ug   c     uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189356: 6626-6780 [-]
intergenic
EM:DU101474: 88-242 [-]
intergenic
Database links

Mature sequence bna-miR169k

Accession MIMAT0005622
Sequence

34 - 

uagccaaggaugacuugccugc

 - 55

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2