Stem-loop sequence bna-MIR169j

AccessionMI0006466 (change log)
DescriptionBrassica napus miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169j
(42 sentences)

Stem-loop
        -u            u    u     -cu    uuc   uc  -c        uuuauacguugaaggguuuuggauuauug 
5' guguu  aguagccaagga gacu gccug   cuug   acc  ca  gauucaac                             u
   |||||  |||||||||||| |||| |||||   ||||   |||  ||  ||||||||                             g
3' uacag  uuaucgguuccu cuga cggac   ggau   ugg  gu  cuaaguug                             c
        uu            -    -     uuu    ---   gu  uu        uacuaaaguuuaauaauauguacaacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189215: 121043-121209 [-]
intergenic
Clustered miRNAs
< 10kb from bna-MIR169j
bna-MIR169jEM:AC189215: 121043-121209 [-]
bna-MIR169fEM:AC189215: 120667-120867 [-]
Database links

Mature sequence bna-miR169j

Accession MIMAT0005621
Sequence

9 - 

uagccaaggaugacuugccugc

 - 30

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).