Stem-loop sequence bna-MIR169i

AccessionMI0006465 (change log)
DescriptionBrassica napus miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169i
(42 sentences)

Stem-loop
       u      u  -          u    u     -cu  u  uca    cau        uuuauguaca                   c 
5' agag cauguu ag uagccaagga gacu gccug   cu uu   ccuc   gauucaau          guuuuggauuacuaugcuu u
   |||| |||||| || |||||||||| |||| |||||   || ||   ||||   ||||||||          ||||||||||||||||||| a
3' uuuc guacag uc aucgguuccu cuga cggac   ga aa   ggag   cuaaguug          uaaaacuuaaugauaugag a
       -      u  u          -    -     uuu  c  -ug    uuu        -------uuc                   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bna-miR169i

Accession MIMAT0005620
Sequence

15 - 

uagccaaggaugacuugccugc

 - 36

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).