Stem-loop sequence bna-MIR169h

AccessionMI0006464 (change log)
DescriptionBrassica napus miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169h
(43 sentences)

Stem-loop
           g   c    --    u     g    g   -     a    u    u      gucuua     ua  u   a       aaa 
5' gagaaaug uga auga  agaa gagaa uugu ugg uagcc agga gacu gccugc      gacca  uc auc aagacua   g
   |||||||| ||| ||||  |||| ||||| |||| ||| ||||| |||| |||| ||||||      |||||  || ||| |||||||   a
3' cucuuuac acu uacu  ucuu cucuu gaca acu aucgg uccu cuga cggaug      uuggu  ag uag uucugau   u
           -   u    cc    u     -    g   u     c    -    -      -gcuaa     ua  -   c       agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ062541: 101-276 [+]
intergenic
EM:CC954204: 39-214 [+]
intergenic
Database links

Mature sequence bna-miR169h

Accession MIMAT0005619
Sequence

37 - 

uagccaaggaugacuugccugc

 - 58

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).