Stem-loop sequence bna-MIR169g

AccessionMI0006463 (change log)
DescriptionBrassica napus miR169g stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169g
(42 sentences)

Stem-loop
         cg    c    --    u   a   u  g   -          u    u      -    uuaac    ua   a     uua 
5' gagaaa  guga auga  agaa gag agu gu ugg uagccaagga gacu gccugc gucu     acca  uca agacu   u
   ||||||  |||| ||||  |||| ||| ||| || ||| |||||||||| |||| |||||| ||||     ||||  ||| |||||    
3' cucuuu  cacu uacu  ucuu cuc uca ca acu aucgguuccu cuga cggaug cgga     uggu  agu ucuga   c
         -a    u    cc    u   c   -  g   u          -    -      u    ----u    ug   c     uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ041682: 86-253 [+]
intergenic
EM:CC943068: 513-680 [-]
intergenic
Database links

Mature sequence bna-miR169g

Accession MIMAT0005618
Sequence

37 - 

uagccaaggaugacuugccugc

 - 58

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).