Stem-loop sequence bna-MIR169f

AccessionMI0006462 (change log)
DescriptionBrassica napus miR169f stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169f
(45 sentences)

Stem-loop
      aa      -au        uc   uu  -          u    u     -cu     -gcgaa g           ggugucauguuugaaagugaaua 
5' guc  agauga   aggagaau  uau  gg uagccaagga gacu gccua   ucuuu      g aaaauggucac                       u
   |||  ||||||   ||||||||  |||  || |||||||||| |||| |||||   |||||      | |||||||||||                        
3' cag  ucuacu   ucuucuug  aua  cc aucgguuccu cuga cggau   agaaa      c uuuuaccagug                       a
      ac      cuu        -u   uu  u          -    -     uau     aauaug g           auuaacuauaugagaauauuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189215: 120667-120867 [-]
intergenic
EM:AC189512: 93875-94075 [-]
intergenic
Clustered miRNAs
< 10kb from bna-MIR169f
bna-MIR169jEM:AC189215: 121043-121209 [-]
bna-MIR169fEM:AC189215: 120667-120867 [-]
Database links

Mature sequence bna-miR169f

Accession MIMAT0005617
Sequence

31 - 

uagccaaggaugacuugccua

 - 51

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).