Stem-loop sequence bna-MIR169e

AccessionMI0006461 (change log)
DescriptionBrassica napus miR169e stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169e
(43 sentences)

Stem-loop
   -guuuc     -   -            uu  c   cuuuu      ca    a      cuuucuuuguauuuuucgaauccaaauaauauuuuuuucuauaaauuuacuacgaaaauccuuuaaacaaucucuaacaaagu 
5'       aggca guc uccuuggcuauc  ga aug     uucuuc  uguu uaccuu                                                                                   a
         ||||| ||| ||||||||||||  || |||     ||||||  |||| ||||||                                                                                    
3'       uccgu cag aggaaccgaugg  uu uac     aagaag  auaa guggaa                                                                                   u
   ucuuua     u   u            -u  a   ----u      --    -      acuguaaaggaagauuucuuacguaugugaguggugcauguacguaaacauuauuuacguuuuucaccaucaaaagauuauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH434672: 301-577 [+]
intergenic
Database links

Mature sequence bna-miR169e

Accession MIMAT0005616
Sequence

252 - 

uagccaaggaugacuugccua

 - 272

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).