Stem-loop sequence bna-MIR169d

AccessionMI0006460 (change log)
DescriptionBrassica napus miR169d stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169d
(45 sentences)

Stem-loop
        -       aa      -au      uuuc   uu  -          u    u     -cu     -gcgaa g           -----     c  g          aa 
5' gaagg agauguc  agauga   aggaga    uau  gg uagccaagga gacu gccua   ucuuu      g aaaauggucac     ggugu au uuugaaagug  u
   ||||| |||||||  ||||||   ||||||    |||  || |||||||||| |||| |||||   |||||      | |||||||||||     ||||| || ||||||||||   
3' cuucc uuuacag  ucuacu   ucuucu    aua  cc aucgguuccu cuga cggau   agaaa      c uuuuaccagug     cuaua ug gaauuuuuac  a
        a       ac      cuu      -ugu   uu  u          -    -     uau     aauaug g           auuaa     -  a          au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BZ014943: 255-474 [-]
intergenic
Database links

Mature sequence bna-miR169d

Accession MIMAT0005615
Sequence

40 - 

uagccaaggaugacuugccua

 - 60

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).