Stem-loop sequence bna-MIR169c

AccessionMI0006459 (change log)
DescriptionBrassica napus miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

11 open access papers mention bna-MIR169c
(44 sentences)

Stem-loop
         -au       u     uu  -          u    u     -uu  --   a   u       gcauggugucauguuaaaagu 
5' agauga   agaagaa cauau  gg uagccaagga gacu gccua   uc  uug gag aaaaugg                     u
   ||||||   ||||||| |||||  || |||||||||| |||| |||||   ||  ||| ||| |||||||                      
3' ucuacu   ucuucuu guaua  cc aucgguuccu cuga cggau   ag  aac uuc uuuuacc                     a
         cuc       -     uu  u          -    -     uau  ua   a   c       aguuuaacuuugauggauguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:ED535040: 841-1016 [-]
intergenic
Database links

Mature sequence bna-miR169c

Accession MIMAT0005614
Sequence

26 - 

uagccaaggaugacuugccua

 - 46

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).