Stem-loop sequence bna-MIR169b

AccessionMI0006458 (change log)
DescriptionBrassica napus miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

11 open access papers mention bna-MIR169b
(44 sentences)

Stem-loop
        -     u  ug  c         u            ugaaau        aauacuuuacuaagacaucuuuucaguuucaaauuugucuu 
5' gugac caaag ag  ug agccaagga gacuugccgauu      auauuuuu                                         g
   ||||| ||||| ||  || ||||||||| ||||||||||||      ||||||||                                         g
3' cgcug guuuc uu  ac ucgguuccu uugaacggcuag      uauaaaaa                                         a
        u     u  gu  a         u            ------        agaaauuugaugcuuuauuuaacauuaaagaaggaucggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189369: 1537-1724 [-]
intergenic
EM:DX901870: 437-624 [+]
intergenic
Database links

Mature sequence bna-miR169b

Accession MIMAT0005613
Sequence

18 - 

cagccaaggaugacuugccga

 - 38

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2