Stem-loop sequence bna-MIR169a

AccessionMI0006457 (change log)
DescriptionBrassica napus miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

11 open access papers mention bna-MIR169a
(45 sentences)

Stem-loop
   u     -     u      c         ug           uaaaauaucugauaaguauuuua 
5'  gugac caaag agugug agccaagga  acuugccgauu                       u
    ||||| ||||| |||||| |||||||||  |||||||||||                       u
3'  cgcug guuuc uugcau ucgguuccu  ugaacggcuag                       u
   g     u     u      a         gu           uacuaaaaaaagaaauuuuaugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DU982154: 662-793 [+]
intergenic
Database links

Mature sequence bna-miR169a

Accession MIMAT0005612
Sequence

19 - 

cagccaaggaugacuugccga

 - 39

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).