Stem-loop sequence bna-MIR171f

AccessionMI0006455 (change log)
DescriptionBrassica napus miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171f
(16 sentences)

Stem-loop
       a    uc  cuuu         c       c      --  ucc   uuacacacg 
5' acga agag  cu    gauauuggc ugguuca ucagau  cu   aga         u
   |||| ||||  ||    ||||||||| ||||||| ||||||  ||   |||         a
3' ugcu ucuc  ga    cuauaaccg gccgagu agucua  ga   ucu         c
       c    gu  --cu         c       u      uu  cuc   uacauauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189627: 79418-79536 [+]
intergenic
EM:DU827625: 17-135 [-]
intergenic
Database links

Mature sequence bna-miR171f

Accession MIMAT0005610
Sequence

84 - 

ugauugagccgcgccaauauc

 - 104

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2