Stem-loop sequence bna-MIR171e

AccessionMI0006454 (change log)
DescriptionBrassica napus miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171e
(14 sentences)

Stem-loop
   caaua  a        ug             -     aca    uuu 
5'      cg gauauugg  ugguucaaucaga aaacc   cucu   g
        || ||||||||  ||||||||||||| |||||   ||||    
3'      gc cuauaacc  gccgaguuaguuu uuugg   gaga   u
   ---ga  a        gu             g     cua    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189214: 74569-74660 [-]
intergenic
Database links

Mature sequence bna-miR171e

Accession MIMAT0005609
Sequence

70 - 

uugagccgugccaauaucacg

 - 90

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2