Stem-loop sequence bna-MIR171d

AccessionMI0006453 (change log)
DescriptionBrassica napus miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171d
(14 sentences)

Stem-loop
      aug  a        ug             -aau  aca    uuu 
5' aca   cg gauauugg  cgguucaaucaga    cc   cucu   g
   |||   || ||||||||  |||||||||||||    ||   ||||    
3' ugu   gc cuauaacc  gccgaguuaguuu    gg   gaga   u
      -ga  a        gu             guuu  cua    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH741911: 143-238 [-]
intergenic
Database links

Mature sequence bna-miR171d

Accession MIMAT0005608
Sequence

71 - 

uugagccgugccaauaucacg

 - 91

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).