Stem-loop sequence bna-MIR171c

AccessionMI0006452 (change log)
DescriptionBrassica napus miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171c
(14 sentences)

Stem-loop
      a      a ug          a     --   ua    uag 
5' gcg gauauu g  cgguucaauc aauag  ucg  cucu   c
   ||| |||||| |  |||||||||| |||||  |||  ||||    
3' cgc cuauaa c  gccgaguuag uuguu  ggc  gaga   u
      a      c gu          c     uu   ua    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DU980843: 159-246 [-]
intergenic
Database links

Mature sequence bna-miR171c

Accession MIMAT0005607
Sequence

67 - 

uugagccgugccaauaucacg

 - 87

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).