Stem-loop sequence bna-MIR171b

AccessionMI0006451 (change log)
DescriptionBrassica napus miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171b
(14 sentences)

Stem-loop
      -a     a      a ug          a     --   ugu    acu 
5' ggu  acgcg gauauu g  cgguucaauc aauag  ucg   ucuc   u
   |||  ||||| |||||| |  |||||||||| |||||  |||   ||||    
3' cca  ugcgc cuauaa c  gccgaguuag uuguu  ggc   agag   g
      ac     a      c gu          c     uu   --u    aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DX044654: 119-219 [+]
intergenic
EM:EE433179: 104-204 [+]
intergenic
Database links

Mature sequence bna-miR171b

Accession MIMAT0005606
Sequence

73 - 

uugagccgugccaauaucacg

 - 93

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2