Stem-loop sequence bna-MIR171a

AccessionMI0006450 (change log)
DescriptionBrassica napus miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention bna-MIR171a
(16 sentences)

Stem-loop
   u   --caa   a      a ug          a     uc   c    agu 
5'  ggu     gcg gauauu g  cgguucaauc aauag  uca ucuu   u
    |||     ||| |||||| |  |||||||||| |||||  ||| ||||    
3'  cca     cgc cuauaa c  gccgaguuag uuguu  agu agag   g
   a   auaua   a      c gu          c     uu   u    aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DY013547: 260-363 [+]
intergenic
EM:ED514994: 153-256 [+]
intergenic
EM:ED515731: 151-254 [+]
intergenic
EM:ED531830: 173-276 [+]
intergenic
Database links

Mature sequence bna-miR171a

Accession MIMAT0005605
Sequence

74 - 

uugagccgugccaauaucacg

 - 94

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).