Stem-loop sequence bna-MIR390c

AccessionMI0006449 (change log)
DescriptionBrassica napus miR390c stem-loop
Gene family MIPF0000101; MIR390
Literature search

7 open access papers mention bna-MIR390c
(9 sentences)

Stem-loop
         --ua      u      aa         g          augacucaucaccauuacu 
5' gcguag    gagaag agcugu  agcucagga ggauagcgcc                   a
   ||||||    |||||| ||||||  ||||||||| ||||||||||                    
3' uguauu    uucuuc ucggua  uugaguccu ccuaucgcgg                   u
         uucg      u      cc         a          uaauguauauguuucugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189355: 75822-75949 [+]
intergenic
EM:CS592994: 982-1109 [+]
intergenic
Database links

Mature sequence bna-miR390c

Accession MIMAT0005604
Sequence

23 - 

aagcucaggagggauagcgcc

 - 43

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).