Stem-loop sequence bna-MIR390b

AccessionMI0006448 (change log)
DescriptionBrassica napus miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

7 open access papers mention bna-MIR390b
(9 sentences)

Stem-loop
       --      au u  a          g           ucaug   aca 
5' guag  agaaga  c gu aagcucagga ggauagcgcca     auc   c
   ||||  ||||||  | || |||||||||| |||||||||||     |||   a
3' cauc  ucuucu  g ua uuugaguccu ccugucgcggu     uag   c
       au      cg u  c          a           uuuua   cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189543: 93838-93942 [+]
intergenic
Database links

Mature sequence bna-miR390b

Accession MIMAT0005603
Sequence

18 - 

aagcucaggagggauagcgcc

 - 38

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2