Stem-loop sequence bna-MIR390a

AccessionMI0006447 (change log)
DescriptionBrassica napus miR390a stem-loop
Gene family MIPF0000101; MIR390
Literature search

7 open access papers mention bna-MIR390a
(9 sentences)

Stem-loop
           -   ugu   u      u       a         g           ugucucaccg    uauaa 
5' auuucagg uga   agu gagaag agcugua agcucagga ggauagcgcca          guac     a
   |||||||| |||   ||| |||||| ||||||| ||||||||| |||||||||||          ||||      
3' uagagucc auu   ucg uucuuc ucgguau uugaguccu ccuaucgcggu          uaug     a
           u   --u   -      u       c         a           --uauaucua    uuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:DU830650: 512-655 [-]
intergenic
EM:DX059137: 530-673 [-]
intergenic
Database links

Mature sequence bna-miR390a

Accession MIMAT0005602
Sequence

33 - 

aagcucaggagggauagcgcc

 - 53

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).