Stem-loop sequence bna-MIR397b

AccessionMI0006446 (change log)
DescriptionBrassica napus miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention bna-MIR397b
(4 sentences)

Stem-loop
         c       g              u  a   --    uu    u 
5' gaacau auugagu cagcguugauguga uu cuu  aucu  uuca u
   |||||| ||||||| |||||||||||||| || |||  ||||  ||||  
3' uuugua uaacucg guugcaacuacauu aa gaa  uagg  aagu g
         u       -              u  c   au    -u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189186: 82670-82765 [-]
intergenic
EM:AC189430: 32971-33066 [-]
intergenic
Database links

Mature sequence bna-miR397b

Accession MIMAT0005601
Sequence

6 - 

ucauugagugcagcguugaugu

 - 27

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2