Stem-loop sequence bna-MIR397a

AccessionMI0006445 (change log)
DescriptionBrassica napus miR397a stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention bna-MIR397a
(6 sentences)

Stem-loop
         c       g              u  a   --c   uu    u 
5' gaacau auugagu cagcguugauguga uu cuu   ucu  uuca u
   |||||| ||||||| |||||||||||||| || |||   |||  ||||  
3' uuugua uaacucg guugcaacuacauu aa gaa   agg  aagu g
         u       -              u  c   auu   -u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH653338: 89-184 [-]
intergenic
Database links

Mature sequence bna-miR397a

Accession MIMAT0005600
Sequence

6 - 

ucauugagugcagcguugaugu

 - 27

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).