Stem-loop sequence hsa-mir-1307

AccessionMI0006444
Symbol HGNC:MIR1307
DescriptionHomo sapiens miR-1307 stem-loop
Gene family MIPF0000558; mir-1307
Stem-loop
   --     ag  -cc       ---  -ac   --c        c a   u       -a  u  a   gc   uc  ug 
5'   cauca  ac   agcugag   uc   ugu   acugccua c auc cgaccgg  cc cg ccg  ucg  ug  u
     |||||  ||   |||||||   ||   |||   |||||||| | ||| |||||||  || || |||  |||  ||   
3'   guggu  ug   ucgacuu   ag   acg   uggcggau g ugg gcuggcu  gg gc ggc  agc  ac  u
   ca     cu  uuc       uua  cau   uac        a a   u       gc  u  -   uc   ua  cg 
Get sequence
Deep sequencing
21573 reads, 2.11e+03 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr10: 103394253-103394401 [-]
sense
OTTHUMT00000049979 ; FBXW4-001; intron 5
OTTHUMT00000049980 ; FBXW4-002; intron 5
ENST00000331272 ; FBXW4-001; intron 5
ENST00000457105 ; FBXW4-002; intron 5
Database links

Mature sequence hsa-miR-1307-5p

Accession MIMAT0022727
Sequence

41 - 

ucgaccggaccucgaccggcu

 - 61

Get sequence
Deep sequencing3373 reads, 54 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-1307-3p

Accession MIMAT0005951
Previous IDshsa-miR-1307
Sequence

80 - 

acucggcguggcgucggucgug

 - 101

Get sequence
Deep sequencing10478 reads, 67 experiments
Evidence experimental; Illumina [1], 454 [2]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).