Stem-loop sequence bra-MIR824

AccessionMI0006439 (change log)
DescriptionBrassica rapa miR824 stem-loop
Gene family MIPF0000442; MIR824
Literature search

5 open access papers mention bra-MIR824
(19 sentences)

       -----    ug    u               u             -uuuuguuu     guuca          aaucuguagugaguauuaaggaaaauagcuuguucaacauaucacacuacucuuuuagaaacaaaacuauauuuuagaugcuuuuccagcuugauauacguuguuuuguuauguauaccuguauucucccggcuaccaaaacguuaagaaauaaggugaacaucuccccaaaaccugcauccaauuagaaaggucuaggucacagccauuacuugcuaucucucgauuaagcuauuuuauu 
5' ccuc     gagu  ucuu caugucuagaccauu gugagaagggauu         gcacc     ccccacucuc                                                                                                                                                                                                                                                 u
   ||||     ||||  |||| ||||||||||||||| |||||||||||||         |||||     ||||||||||                                                                                                                                                                                                                                                 c
3' ggag     cuca  ggag guguagaucugguag uacucuucccuga         cgugg     ggggugaggg                                                                                                                                                                                                                                                 u
       uuacu    gu    c               c             uuauugggu     ---aa          guucaauaaaugauacuucauuugaucacaucgauucaucacguucuaaguucaagaaucgauaguacuuuauggagauugugaggucugucuccaaacuguagagcauccuuuuuacagacaggcuucacaccguaucagguuuuuguuuuauaauacauacgucguaggucuuuacaguacuuaccugaauuacauaaaauaaaauaugaauugaggacuuacuagacuacuacuacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 25613141-25613772 [+]
Database links

Mature sequence bra-miR824

Accession MIMAT0005598

22 - 


 - 42

Get sequence
Evidence experimental; Northern [1]


PMID:17704216 "MicroRNA-mediated regulation of stomatal development in Arabidopsis" Kutter C, Schob H, Stadler M, Meins F Jr, Si-Ammour A Plant Cell. 19:2417-2429(2007).