Stem-loop sequence hsa-mir-1255b-2

Accession MI0006436
Symbol HGNC:MIR1255B2
Description Homo sapiens miR-1255b-2 stem-loop
Gene family MIPF0000506; mir-1255
Stem-loop 
-     c                      g gc 
 ucuua ggaugagcaaagaaagugguuu c  c
 ||||| |||||||||||||||||||||| |  u
 ggaau ccuacucguuucuuucaccaaa g  c
a     a                      - aa
Get sequence
Deep sequencing
172 reads, 16 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 167967898-167967964 [+]
sense
OTTHUMT00000157115 ; DCAF6-011; intron 7
OTTHUMT00000083660 ; DCAF6-002; intron 7
OTTHUMT00000083661 ; DCAF6-003; intron 7
OTTHUMT00000083659 ; DCAF6-001; intron 7
OTTHUMT00000157115 ; DCAF6-011; intron 7
OTTHUMT00000083660 ; DCAF6-002; intron 7
OTTHUMT00000083661 ; DCAF6-003; intron 7
OTTHUMT00000083659 ; DCAF6-001; intron 7
OTTHUMT00000157115 ; DCAF6-011; intron 7
OTTHUMT00000083660 ; DCAF6-002; intron 7
OTTHUMT00000083661 ; DCAF6-003; intron 7
OTTHUMT00000083659 ; DCAF6-001; intron 7
ENST00000432587 ; DCAF6-201; intron 6
ENST00000432587 ; DCAF6-201; intron 6
ENST00000432587 ; DCAF6-201; intron 6
ENST00000367843 ; DCAF6-011; intron 7
ENST00000470721 ; DCAF6-002; intron 7
ENST00000312263 ; DCAF6-003; intron 7
ENST00000367840 ; DCAF6-001; intron 7
ENST00000367843 ; DCAF6-011; intron 7
ENST00000470721 ; DCAF6-002; intron 7
ENST00000312263 ; DCAF6-003; intron 7
ENST00000367840 ; DCAF6-001; intron 7
ENST00000367843 ; DCAF6-011; intron 7
ENST00000470721 ; DCAF6-002; intron 7
ENST00000312263 ; DCAF6-003; intron 7
ENST00000367840 ; DCAF6-001; intron 7
Database links

Mature sequence hsa-miR-1255b-5p

Accession MIMAT0005945
Previous IDs hsa-miR-1255b
Sequence

6 -  

cggaugagcaaagaaagugguu

 - 27

Get sequence
Deep sequencing 341 reads, 16 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-1255b-2-3p

Accession MIMAT0022725
Sequence

40 -  

aaccacuuucuuugcucaucca

 - 61

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).