Stem-loop sequence hsa-mir-1255b-2

AccessionMI0006436 (change log)
Symbol HGNC:MIR1255B2
DescriptionHomo sapiens miR-1255b-2 stem-loop
Gene family MIPF0000506; mir-1255
Literature search

4 open access papers mention hsa-mir-1255b-2
(4 sentences)

Stem-loop
   -     c                      g gc 
5'  ucuua ggaugagcaaagaaagugguuu c  c
    ||||| |||||||||||||||||||||| |  u
3'  ggaau ccuacucguuucuuucaccaaa g  c
   a     a                      - aa 
Get sequence
Deep sequencing
4198 reads, 4.5 reads per million, 111 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 167998660-167998726 [+]
sense
OTTHUMT00000083661 ; DCAF6-003; intron 10
OTTHUMT00000157115 ; DCAF6-011; intron 11
OTTHUMT00000083659 ; DCAF6-001; intron 12
ENST00000312263 ; DCAF6-003; intron 10
ENST00000367843 ; DCAF6-011; intron 11
ENST00000432587 ; DCAF6-201; intron 11
ENST00000367840 ; DCAF6-001; intron 12
Database links

Mature sequence hsa-miR-1255b-5p

Accession MIMAT0005945
Previous IDshsa-miR-1255b
Sequence

6 - 

cggaugagcaaagaaagugguu

 - 27

Get sequence
Deep sequencing8361 reads, 111 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-1255b-2-3p

Accession MIMAT0022725
Sequence

40 - 

aaccacuuucuuugcucaucca

 - 61

Get sequence
Deep sequencing20 reads, 13 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).