|
miRBase |
|
Stem-loop sequence hsa-mir-1255b-1 |
|||||
| Accession | MI0006435 | ||||
| Symbol | HGNC:MIR1255B1 | ||||
| Description | Homo sapiens miR-1255b-1 stem-loop | ||||
| Gene family | MIPF0000506; mir-1255 | ||||
| Stem-loop |
-- ---a ga aa u ua uacgg u gcaaaga gugg uucu a ||||| | ||||||| |||| |||| guguc a uguuucu cauc aagg a aa guag ag -- u ua |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-1255b-5p |
|
| Accession | MIMAT0005945 |
| Previous IDs | hsa-miR-1255b |
| Sequence |
3 - cggaugagcaaagaaagugguu - 24 |
| Deep sequencing | 341 reads, 16 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|