Stem-loop sequence hsa-mir-1252

AccessionMI0006434
Symbol HGNC:MIR1252
DescriptionHomo sapiens miR-1252 stem-loop
Gene family MIPF0000968; mir-1252
Stem-loop
                    a       a   aa 
5' agaaagaaggaaauuga uucauuu gaa  g
   ||||||||||||||||| ||||||| |||  a
3' ucuuuuuuccuuuaauu gaguaaa cuu  g
                    c       c   aa 
Get sequence
Deep sequencing
32 reads, 41.4 reads per million, 12 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr12: 79419257-79419321 [+]
sense
OTTHUMT00000407111 ; SYT1-010; intron 1
OTTHUMT00000259415 ; SYT1-001; intron 2
OTTHUMT00000407107 ; SYT1-004; intron 2
OTTHUMT00000407108 ; SYT1-007; intron 2
OTTHUMT00000407110 ; SYT1-009; intron 2
OTTHUMT00000407112 ; SYT1-011; intron 2
OTTHUMT00000259416 ; SYT1-002; intron 3
OTTHUMT00000407109 ; SYT1-008; intron 4
ENST00000549671 ; SYT1-010; intron 1
ENST00000261205 ; SYT1-001; intron 2
ENST00000457153 ; SYT1-004; intron 2
ENST00000552074 ; SYT1-007; intron 2
ENST00000547046 ; SYT1-009; intron 2
ENST00000551304 ; SYT1-011; intron 2
ENST00000393240 ; SYT1-002; intron 3
ENST00000549454 ; SYT1-008; intron 4
antisense
OTTHUMT00000407117 ; RP11-390N6.1-001; intron 2
ENST00000548384 ; RP11-390N6.1-001; intron 2
Database links

Mature sequence hsa-miR-1252-5p

Accession MIMAT0005944
Sequence

5 - 

agaaggaaauugaauucauuua

 - 26

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-1252-3p

Accession MIMAT0026744
Sequence

40 - 

caaaugagcuuaauuuccuuuu

 - 61

Get sequence
Deep sequencing8 reads, 5 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).