Stem-loop sequence hsa-mir-1288

Accession MI0006432
Symbol HGNC:MIR1288
Description Homo sapiens miR-1288 stem-loop
Gene family MIPF0000660; mir-1288
Stem-loop 
g     gu  a  ag         acu   ac     a 
 agggu  ug uc  cagaucagg   gua  ucacc u
 |||||  || ||  |||||||||   |||  ||||| a
 uuccg  ac ag  gucuagucc   cgu  ggugg g
-     uc  c  ag         ---   ca     u
Get sequence
Deep sequencing
4 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 16185328-16185402 [+]
sense
OTTHUMT00000444953 ; PIGL-009; intron 1
OTTHUMT00000131881 ; PIGL-001; intron 2
OTTHUMT00000131882 ; PIGL-002; intron 2
OTTHUMT00000131885 ; PIGL-005; intron 2
OTTHUMT00000131886 ; PIGL-006; intron 2
OTTHUMT00000131881 ; PIGL-001; intron 2
OTTHUMT00000131882 ; PIGL-002; intron 2
OTTHUMT00000131885 ; PIGL-005; intron 2
OTTHUMT00000131886 ; PIGL-006; intron 2
OTTHUMT00000444951 ; PIGL-012; intron 2
OTTHUMT00000444952 ; PIGL-010; intron 2
OTTHUMT00000131882 ; PIGL-002; intron 2
OTTHUMT00000131885 ; PIGL-005; intron 2
OTTHUMT00000131881 ; PIGL-001; intron 2
OTTHUMT00000131886 ; PIGL-006; intron 2
OTTHUMT00000131887 ; PIGL-007; intron 3
OTTHUMT00000131887 ; PIGL-007; intron 3
OTTHUMT00000131887 ; PIGL-007; intron 3
ENST00000585034 ; PIGL-009; intron 1
ENST00000225609 ; PIGL-001; intron 2
ENST00000498772 ; PIGL-002; intron 2
ENST00000395844 ; PIGL-005; intron 2
ENST00000477745 ; PIGL-006; intron 2
ENST00000225609 ; PIGL-001; intron 2
ENST00000498772 ; PIGL-002; intron 2
ENST00000395844 ; PIGL-005; intron 2
ENST00000477745 ; PIGL-006; intron 2
ENST00000581006 ; PIGL-012; intron 2
ENST00000584797 ; PIGL-010; intron 2
ENST00000498772 ; PIGL-002; intron 2
ENST00000395844 ; PIGL-005; intron 2
ENST00000225609 ; PIGL-001; intron 2
ENST00000477745 ; PIGL-006; intron 2
ENST00000470116 ; PIGL-007; intron 3
ENST00000470116 ; PIGL-007; intron 3
ENST00000470116 ; PIGL-007; intron 3
Database links

Mature sequence hsa-miR-1288

Accession MIMAT0005942
Sequence

45 -  

uggacugcccugaucuggaga

 - 65

Get sequence
Deep sequencing 4 reads, 4 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).