Stem-loop sequence hsa-mir-1284

Accession

MI0006431

Symbol

HGNC:MIR1284

Description

Homo sapiens miR-1284 stem-loop

Gene family

MIPF0000604; mir-1284

Stem-loop

--------auuu   uauau        uuaau      u        ccu        uuaaauu 
            uga     aagccagu     guuuuc auacagac   ggcuuuuc       u
            |||     ||||||||     |||||| ||||||||   ||||||||        
            acu     uuuggucg     caaagg uauguuug   ccgaaagg       u
ucuaaaagucau   --uuc        ----u      u        uac        uuauaua 

Deep sequencing

6 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr3: 71591121-71591240 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000352253 ; FOXP1-004; intron 1

  OTTHUMT00000352263 ; FOXP1-015; intron 1

  OTTHUMT00000352264 ; FOXP1-016; intron 1

  OTTHUMT00000352253 ; FOXP1-004; intron 1

  OTTHUMT00000352263 ; FOXP1-015; intron 1

  OTTHUMT00000352264 ; FOXP1-016; intron 1

  OTTHUMT00000352253 ; FOXP1-004; intron 1

  OTTHUMT00000352263 ; FOXP1-015; intron 1

  OTTHUMT00000352264 ; FOXP1-016; intron 1

  OTTHUMT00000352250 ; FOXP1-001; intron 2

  OTTHUMT00000352251 ; FOXP1-002; intron 2

  OTTHUMT00000352262 ; FOXP1-014; intron 2

  OTTHUMT00000352250 ; FOXP1-001; intron 2

  OTTHUMT00000352251 ; FOXP1-002; intron 2

  OTTHUMT00000352262 ; FOXP1-014; intron 2

  OTTHUMT00000352250 ; FOXP1-001; intron 2

  OTTHUMT00000352251 ; FOXP1-002; intron 2

  OTTHUMT00000352262 ; FOXP1-014; intron 2

  ENST00000475937 ; FOXP1-004; intron 1

  ENST00000498154 ; FOXP1-015; intron 1

  ENST00000471386 ; FOXP1-016; intron 1

  ENST00000475937 ; FOXP1-004; intron 1

  ENST00000498154 ; FOXP1-015; intron 1

  ENST00000471386 ; FOXP1-016; intron 1

  ENST00000475937 ; FOXP1-004; intron 1

  ENST00000498154 ; FOXP1-015; intron 1

  ENST00000471386 ; FOXP1-016; intron 1

  ENST00000318789 ; FOXP1-001; intron 2

  ENST00000493089 ; FOXP1-002; intron 2

  ENST00000318779 ; FOXP1-014; intron 2

  ENST00000339693 ; FOXP1-202; intron 2

  ENST00000318796 ; FOXP1-201; intron 2

  ENST00000318789 ; FOXP1-001; intron 2

  ENST00000493089 ; FOXP1-002; intron 2

  ENST00000318779 ; FOXP1-014; intron 2

  ENST00000339693 ; FOXP1-202; intron 2

  ENST00000318796 ; FOXP1-201; intron 2

  ENST00000318789 ; FOXP1-001; intron 2

  ENST00000493089 ; FOXP1-002; intron 2

  ENST00000318779 ; FOXP1-014; intron 2

Database links

• ENTREZGENE: 100302112;MIR1284
• HGNC: 35362;MIR1284

Mature sequence hsa-miR-1284

• Accession: MIMAT0005941
• Sequence: 30 - ucuauacagacccuggcuuuuc - 51
• Deep sequencing: 6 reads, 3 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1284
  • MICRORNA.ORG:hsa-miR-1284
  • MIRDB:hsa-miR-1284
  • RNA22-HSA:hsa-miR-1284
  • TARGETMINER:hsa-miR-1284
  • TARGETSCAN-VERT:hsa-miR-1284

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).