Stem-loop sequence hsa-mir-1283-2

AccessionMI0006430 (change log)
Symbol HGNC:MIR1283-2
DescriptionHomo sapiens miR-1283-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

5 open access papers mention hsa-mir-1283-2
(7 sentences)

Stem-loop
   --            gu  a      a     c     guug  u 
5'   cucaagcuguga  cu caaagg aagcg uuucu    uc g
     ||||||||||||  || |||||| ||||| |||||    || a
3'   gaguuuggcauu  ga guuucc uucgc aaaga    ag a
   aa            gu  g      c     u     --aa  a 
Get sequence
Deep sequencing
2444 reads, 102 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53758232-53758318 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1283-2
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
hsa-mir-519a-2chr19: 53762344-53762430 [+]
Database links

Mature sequence hsa-miR-1283

Accession MIMAT0005799
Sequence

14 - 

ucuacaaaggaaagcgcuuucu

 - 35

Get sequence
Deep sequencing4006 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).