|
miRBase |
|
Stem-loop sequence hsa-mir-1278 |
|||||
| Accession | MI0006425 | ||||
| Symbol | HGNC:MIR1278 | ||||
| Description | Homo sapiens miR-1278 stem-loop | ||||
| Gene family | MIPF0000591; mir-1278 | ||||
| Stem-loop |
-- c ga c auuugcucauagaugauaugcauaguacu cca acu a ||||||||||||||||||||||||||||| ||| ||| u uaagcgaguaucuacuauacgugucauga ggu uga u ga u -- a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1278 |
|
| Accession | MIMAT0005936 |
| Sequence |
50 - uaguacugugcauaucaucuau - 71 |
| Deep sequencing | 411 reads, 13 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|