Stem-loop sequence hsa-mir-548i-4

AccessionMI0006424 (change log)
Symbol HGNC:MIR548I4
DescriptionHomo sapiens miR-548i-4 stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548i-4
(146 sentences)

Stem-loop
   --            a    a   c  a       auac 
5'   agguuggugcaa agua uug gg uuuugcc    u
     |||||||||||| |||| ||| || |||||||    u
3'   uccaaccacguu uuau aac cc aaaacgg    u
   ua            a    a   a  a       caau 
Get sequence
Deep sequencing
9771 reads, 16.9 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 84225752-84225828 [-]
intergenic
Database links

Mature sequence hsa-miR-548i

Accession MIMAT0005935
Sequence

11 - 

aaaaguaauugcggauuuugcc

 - 32

Get sequence
Deep sequencing37421 reads, 148 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).