Stem-loop sequence hsa-mir-548p

Accession MI0006420
Symbol HGNC:MIR548P
Description Homo sapiens miR-548p stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
--    g      a     u               uc   ac 
  auua guuggu uaaaa uaauugcaguuuuug  auu  u
  |||| |||||| ||||| |||||||||||||||  |||   
  uaau uaacca guuuu auugacgucaaaaac  uaa  u
ca    g      c     c               ga   cu
Get sequence
Deep sequencing
58 reads, 14 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 100152186-100152269 [-]
sense
OTTHUMT00000250632 ; ST8SIA4-001; intron 4
OTTHUMT00000250632 ; ST8SIA4-001; intron 4
OTTHUMT00000250632 ; ST8SIA4-001; intron 4
ENST00000231461 ; ST8SIA4-001; intron 4
ENST00000231461 ; ST8SIA4-001; intron 4
ENST00000231461 ; ST8SIA4-001; intron 4
Database links

Mature sequence hsa-miR-548p

Accession MIMAT0005934
Sequence

47 -  

uagcaaaaacugcaguuacuuu

 - 68

Get sequence
Deep sequencing 57 reads, 13 experiments
Evidence experimental; Solexa [1]
Validated targets
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).