Stem-loop sequence hsa-mir-548p

AccessionMI0006420 (change log)
Symbol HGNC:MIR548P
DescriptionHomo sapiens miR-548p stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548p
(142 sentences)

Stem-loop
   --    g      a     u               uc   ac 
5'   auua guuggu uaaaa uaauugcaguuuuug  auu  u
     |||| |||||| ||||| |||||||||||||||  |||   
3'   uaau uaacca guuuu auugacgucaaaaac  uaa  u
   ca    g      c     c               ga   cu 
Get sequence
Deep sequencing
4011 reads, 7.14 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 100816482-100816565 [-]
intergenic
Database links

Mature sequence hsa-miR-548p

Accession MIMAT0005934
Sequence

47 - 

uagcaaaaacugcaguuacuuu

 - 68

Get sequence
Deep sequencing3554 reads, 122 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).