Stem-loop sequence hsa-mir-1276

Accession MI0006416
Symbol HGNC:MIR1276
Description Homo sapiens miR-1276 stem-loop
Gene family MIPF0000652; mir-1276
Stem-loop 
--  -   gcu    -a   a  c u         ---- -   g 
  cc cca   aggu  aag gc c guggagaca    c cug a
  || |||   ||||  ||| || | |||||||||    | |||  
  gg ggu   uccg  uuc cg g caccucugu    g gac u
uc  c   agu    gg   a  a u         acaa a   u
Get sequence
Deep sequencing
139 reads, 13 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 86313727-86313809 [-]
sense
OTTHUMT00000309023 ; KLHL25-001; intron 1
OTTHUMT00000309023 ; KLHL25-001; intron 1
OTTHUMT00000417353 ; KLHL25-002; intron 1
OTTHUMT00000309023 ; KLHL25-001; intron 1
OTTHUMT00000417353 ; KLHL25-002; intron 1
ENST00000337975 ; KLHL25-001; intron 1
ENST00000538153 ; KLHL25-202; intron 1
ENST00000536947 ; KLHL25-201; intron 1
ENST00000337975 ; KLHL25-001; intron 1
ENST00000559131 ; KLHL25-002; intron 1
ENST00000538153 ; KLHL25-202; intron 1
ENST00000536947 ; KLHL25-201; intron 1
ENST00000337975 ; KLHL25-001; intron 1
ENST00000559131 ; KLHL25-002; intron 1
ENST00000536947 ; KLHL25-201; intron 1
Database links

Mature sequence hsa-miR-1276

Accession MIMAT0005930
Sequence

12 -  

uaaagagcccuguggagaca

 - 31

Get sequence
Deep sequencing 139 reads, 13 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).