Stem-loop sequence hsa-mir-548h-3

AccessionMI0006413 (change log)
Symbol HGNC:MIR548H3
DescriptionHomo sapiens miR-548h-3 stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548h-3
(147 sentences)

Stem-loop
   --     -------uu    augua                     c          uc    a 
5'   ucuga         cugc     uuagguuggugcaaaaguaau gcgguuuuug  auug a
     |||||         ||||     ||||||||||||||||||||| ||||||||||  ||||  
3'   agacu         gaug     aauccaaccacguuuucauua cgucaaaaac  uaau a
   au     ucugucacu    ---aa                     a          ga    g 
Get sequence
Deep sequencing
11308 reads, 6.54 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 13543529-13543646 [-]
intergenic
Database links

Mature sequence hsa-miR-548h-5p

Accession MIMAT0005928
Previous IDshsa-miR-548h
Sequence

29 - 

aaaaguaaucgcgguuuuuguc

 - 50

Get sequence
Deep sequencing29178 reads, 146 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).