Stem-loop sequence hsa-mir-548h-3

Accession MI0006413
Symbol HGNC:MIR548H3
Description Homo sapiens miR-548h-3 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
--     -------uu    augua                     c          uc    a 
  ucuga         cugc     uuagguuggugcaaaaguaau gcgguuuuug  auug a
  |||||         ||||     ||||||||||||||||||||| ||||||||||  ||||  
  agacu         gaug     aauccaaccacguuuucauua cgucaaaaac  uaau a
au     ucugucacu    ---aa                     a          ga    g
Get sequence
Deep sequencing
143 reads, 18 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 13446846-13446963 [-]
sense
OTTHUMT00000129952 ; HS3ST3A1-001; intron 1
OTTHUMT00000129952 ; HS3ST3A1-001; intron 1
OTTHUMT00000129952 ; HS3ST3A1-001; intron 1
OTTHUMT00000447603 ; HS3ST3A1-002; intron 1
ENST00000284110 ; HS3ST3A1-001; intron 1
ENST00000284110 ; HS3ST3A1-001; intron 1
ENST00000284110 ; HS3ST3A1-001; intron 1
ENST00000578576 ; HS3ST3A1-002; intron 1
Database links

Mature sequence hsa-miR-548h-5p

Accession MIMAT0005928
Previous IDs hsa-miR-548h
Sequence

29 -  

aaaaguaaucgcgguuuuuguc

 - 50

Get sequence
Deep sequencing 167 reads, 7 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).