Stem-loop sequence hsa-mir-548h-1

Accession

MI0006411

Symbol

HGNC:MIR548H1

Description

Homo sapiens miR-548h-1 stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

--    u ----c       g              cg        gu     c 
  ucug c     auuaggu ggugcaaaaguaau  cgguuuuu  cauua u
  |||| |     ||||||| ||||||||||||||  ||||||||  |||||  
  agac g     uaaucca ucacguuuucauua  gucaaaaa  guaau u
au    c aauua       g              ag        ug     u 

Deep sequencing

45 reads, 8 experiments

Genome context

• Coordinates (GRCh37.p5): chr14: 64561742-64561843 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000412154 ; ESR2-004; intron 8

  OTTHUMT00000412154 ; ESR2-004; intron 8

  OTTHUMT00000412154 ; ESR2-004; intron 8

  ENST00000556275 ; ESR2-004; intron 8

  ENST00000542956 ; ESR2-204; intron 8

  ENST00000556275 ; ESR2-004; intron 8

  ENST00000542956 ; ESR2-204; intron 8

  ENST00000556275 ; ESR2-004; intron 8

  ENST00000542956 ; ESR2-204; intron 8

  antisense

  OTTHUMT00000412133 ; SYNE2-012; intron 9

  OTTHUMT00000412134 ; SYNE2-014; intron 9

  OTTHUMT00000412133 ; SYNE2-012; intron 9

  OTTHUMT00000412134 ; SYNE2-014; intron 9

  OTTHUMT00000412133 ; SYNE2-012; intron 9

  OTTHUMT00000412134 ; SYNE2-014; intron 9

  OTTHUMT00000412132 ; SYNE2-011; intron 12

  OTTHUMT00000412132 ; SYNE2-011; intron 12

  OTTHUMT00000412132 ; SYNE2-011; intron 12

  OTTHUMT00000276994 ; SYNE2-001; intron 61

  OTTHUMT00000411905 ; SYNE2-002; intron 61

  OTTHUMT00000276994 ; SYNE2-001; intron 61

  OTTHUMT00000411905 ; SYNE2-002; intron 61

  OTTHUMT00000276994 ; SYNE2-001; intron 61

  OTTHUMT00000411905 ; SYNE2-002; intron 61

  ENST00000557060 ; SYNE2-012; intron 9

  ENST00000394768 ; SYNE2-014; intron 9

  ENST00000557060 ; SYNE2-012; intron 9

  ENST00000394768 ; SYNE2-014; intron 9

  ENST00000557060 ; SYNE2-012; intron 9

  ENST00000394768 ; SYNE2-014; intron 9

  ENST00000555002 ; SYNE2-011; intron 12

  ENST00000555002 ; SYNE2-011; intron 12

  ENST00000555002 ; SYNE2-011; intron 12

  ENST00000344113 ; SYNE2-001; intron 61

  ENST00000554584 ; SYNE2-002; intron 61

  ENST00000261678 ; SYNE2-201; intron 61

  ENST00000358025 ; SYNE2-204; intron 61

  ENST00000344113 ; SYNE2-001; intron 61

  ENST00000554584 ; SYNE2-002; intron 61

  ENST00000261678 ; SYNE2-201; intron 61

  ENST00000358025 ; SYNE2-204; intron 61

  ENST00000344113 ; SYNE2-001; intron 61

  ENST00000554584 ; SYNE2-002; intron 61

  ENST00000358025 ; SYNE2-203; intron 61

  ENST00000357395 ; SYNE2-203; intron 62

  ENST00000357395 ; SYNE2-203; intron 62

  ENST00000357395 ; SYNE2-202; intron 62

Database links

• ENTREZGENE: 100302249;MIR548H-1
• HGNC: 35342;MIR548H1

Mature sequence hsa-miR-548h-5p

• Accession: MIMAT0005928
• Previous IDs: hsa-miR-548h
• Sequence: 21 - aaaaguaaucgcgguuuuuguc - 42
• Deep sequencing: 167 reads, 7 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548h-5p
  • MICRORNA.ORG:hsa-miR-548h-5p
  • MIRDB:hsa-miR-548h-5p
  • RNA22-HSA:hsa-miR-548h-5p
  • TARGETMINER:hsa-miR-548h-5p
  • TARGETSCAN-VERT:hsa-miR-548h

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).