|
miRBase |
|
Stem-loop sequence hsa-mir-1266 |
|||||
| Accession | MI0006403 | ||||
| Symbol | HGNC:MIR1266 | ||||
| Description | Homo sapiens miR-1266 stem-loop | ||||
| Gene family | MIPF0000615; mir-1266 | ||||
| Stem-loop |
-- --gg u -- g aca uagugucccucagggc guagaacagggcu gg a ||| |||||||||||||||| ||||||||||||| || u ugu gucacagggagucccg uaucuugucccga uc u ac acga - aa a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1266 |
|
| Accession | MIMAT0005920 |
| Sequence |
13 - ccucagggcuguagaacagggcu - 35 |
| Deep sequencing | 36 reads, 6 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|