Stem-loop sequence hsa-mir-548o

AccessionMI0006402 (change log)
Symbol HGNC:MIR548O
DescriptionHomo sapiens miR-548o stem-loop
Literature search

42 open access papers mention hsa-mir-548o
(143 sentences)

Stem-loop
   --     a   ugu  u       ---a   uu  ---u   -cu     -aua   au   u 
5'   uggug aaa   gu gauugua    ugg  cc    auu   gauca    aac  ggu u
     ||||| |||   || |||||||    |||  ||    |||   |||||    |||  |||  
3'   accac uuu   ca uugacgu    acc  gg    uaa   cuagu    uug  ccg g
   ca     g   --u  -       caaa   -u  cacu   aau     aaca   au   a 
Get sequence
Deep sequencing
2655 reads, 5.43 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 102405742-102405855 [-]
antisense
OTTHUMT00000334053 ; FAM185A-003; intron 3
OTTHUMT00000334056 ; FAM185A-006; intron 4
OTTHUMT00000334052 ; FAM185A-002; intron 4
OTTHUMT00000334057 ; FAM185A-007; intron 4
OTTHUMT00000334051 ; FAM185A-001; intron 4
OTTHUMT00000349482 ; FAM185A-009; intron 4
ENST00000409231 ; FAM185A-003; intron 3
ENST00000481697 ; FAM185A-006; intron 4
ENST00000442873 ; FAM185A-002; intron 4
ENST00000487807 ; FAM185A-007; intron 4
ENST00000420217 ; FAM185A-001; intron 4
ENST00000413034 ; FAM185A-009; intron 4
Database links

Mature sequence hsa-miR-548o-3p

Accession MIMAT0005919
Previous IDshsa-miR-548o
Sequence

87 - 

ccaaaacugcaguuacuuuugc

 - 108

Get sequence
Deep sequencing5269 reads, 130 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).