Stem-loop sequence hsa-mir-548o

Accession MI0006402
Symbol HGNC:MIR548O
Description Homo sapiens miR-548o stem-loop
Stem-loop 
--     a   ugu  u       ---a   uu  ---u   -cu     -aua   au   u 
  uggug aaa   gu gauugua    ugg  cc    auu   gauca    aac  ggu u
  ||||| |||   || |||||||    |||  ||    |||   |||||    |||  |||  
  accac uuu   ca uugacgu    acc  gg    uaa   cuagu    uug  ccg g
ca     g   --u  -       caaa   -u  cacu   aau     aaca   au   a
Get sequence
Deep sequencing
reads, experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 102046189-102046302 [-]
antisense
OTTHUMT00000349484 ; PRKRIP1-002; intron 1
OTTHUMT00000349484 ; PRKRIP1-002; intron 1
OTTHUMT00000349484 ; PRKRIP1-002; intron 1
OTTHUMT00000349487 ; PRKRIP1-005; intron 3
OTTHUMT00000349487 ; PRKRIP1-005; intron 3
OTTHUMT00000349487 ; PRKRIP1-005; intron 3
OTTHUMT00000349483 ; PRKRIP1-001; intron 4
OTTHUMT00000349483 ; PRKRIP1-001; intron 4
OTTHUMT00000349483 ; PRKRIP1-001; intron 4
OTTHUMT00000349488 ; PRKRIP1-006; intron 6
OTTHUMT00000349488 ; PRKRIP1-006; intron 6
OTTHUMT00000349488 ; PRKRIP1-006; intron 6
OTTHUMT00000349486 ; PRKRIP1-004; intron 7
OTTHUMT00000349490 ; PRKRIP1-008; intron 7
OTTHUMT00000349486 ; PRKRIP1-004; intron 7
OTTHUMT00000349490 ; PRKRIP1-008; intron 7
OTTHUMT00000349486 ; PRKRIP1-004; intron 7
OTTHUMT00000349490 ; PRKRIP1-008; intron 7
OTTHUMT00000349489 ; PRKRIP1-007; intron 8
OTTHUMT00000349489 ; PRKRIP1-007; intron 8
OTTHUMT00000349489 ; PRKRIP1-007; intron 8
ENST00000468316 ; PRKRIP1-002; intron 1
ENST00000468316 ; PRKRIP1-002; intron 1
ENST00000468316 ; PRKRIP1-002; intron 1
ENST00000462601 ; PRKRIP1-005; intron 3
ENST00000462601 ; PRKRIP1-005; intron 3
ENST00000462601 ; PRKRIP1-005; intron 3
ENST00000397912 ; PRKRIP1-001; intron 4
ENST00000354783 ; PRKRIP1-201; intron 4
ENST00000397912 ; PRKRIP1-001; intron 4
ENST00000354783 ; PRKRIP1-201; intron 4
ENST00000397912 ; PRKRIP1-001; intron 4
ENST00000354783 ; PRKRIP1-201; intron 4
ENST00000482465 ; PRKRIP1-006; intron 6
ENST00000482465 ; PRKRIP1-006; intron 6
ENST00000482465 ; PRKRIP1-006; intron 6
ENST00000469763 ; PRKRIP1-008; intron 7
ENST00000482549 ; PRKRIP1-004; intron 7
ENST00000469763 ; PRKRIP1-008; intron 7
ENST00000482549 ; PRKRIP1-004; intron 7
ENST00000469763 ; PRKRIP1-008; intron 7
ENST00000482549 ; PRKRIP1-004; intron 7
ENST00000496391 ; PRKRIP1-007; intron 8
ENST00000496391 ; PRKRIP1-007; intron 8
ENST00000496391 ; PRKRIP1-007; intron 8
Database links

Mature sequence hsa-miR-548o-3p

Accession MIMAT0005919
Previous IDs hsa-miR-548o
Sequence

87 -  

ccaaaacugcaguuacuuuugc

 - 108

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).