|
miRBase |
|
Stem-loop sequence hsa-mir-1258 |
|||||
| Accession | MI0006392 | ||||
| Symbol | HGNC:MIR1258 | ||||
| Description | Homo sapiens miR-1258 stem-loop | ||||
| Gene family | MIPF0000684; mir-1258 | ||||
| Stem-loop |
-- ugcg
cuguggcuuccacgaccuaauccuaacucc a
|||||||||||||||||||||||||||||| g
gacaccgaaggugcuggauuaggauugagg u
ag uccc
|
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1258 |
|
| Accession | MIMAT0005909 |
| Sequence |
44 - aguuaggauuaggucguggaa - 64 |
| Evidence | experimental; Solexa [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|