Stem-loop sequence hsa-mir-1258

AccessionMI0006392
Symbol HGNC:MIR1258
DescriptionHomo sapiens miR-1258 stem-loop
Gene family MIPF0000684; mir-1258
Stem-loop
   --                              ugcg 
5'   cuguggcuuccacgaccuaauccuaacucc    a
     ||||||||||||||||||||||||||||||    g
3'   gacaccgaaggugcuggauuaggauugagg    u
   ag                              uccc 
Get sequence
Deep sequencing
198 reads, 22.4 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr2: 179860836-179860908 [-]
sense
OTTHUMT00000335874 ; CCDC141-004; intron 2
OTTHUMT00000335875 ; CCDC141-005; intron 2
OTTHUMT00000335873 ; CCDC141-003; intron 2
ENST00000443758 ; CCDC141-004; intron 2
ENST00000446116 ; CCDC141-005; intron 2
ENST00000409284 ; CCDC141-003; intron 2
ENST00000420890 ; CCDC141-202; intron 2
Database links

Mature sequence hsa-miR-1258

Accession MIMAT0005909
Sequence

44 - 

aguuaggauuaggucguggaa

 - 64

Get sequence
Deep sequencing28 reads, 9 experiments
Evidence experimental; Illumina [1]
Validated targets
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).